biology revision quiz 4 lizzie 0.0 / 5 ? BiologyDNA and inheritanceGCSEEdexcel Created by: ollysmellsCreated on: 17-10-22 09:28 what does a lack of vitamin c in the body cause? scurvy 1 of 9 which cell growth process produces daughter cells? mitosis 2 of 9 at what stage of protean synthesis can mutation occur transcription 3 of 9 what protean does the codon AUU form? lle 4 of 9 what can the human genome tell about a person? possible illnesses in future 5 of 9 que decide el color de tus ojos OCA2 6 of 9 match this up: ATCGGACTTACTACCGGGATT TAGCCTGAATGATGGCCCTAA 7 of 9 a father has the gametes Xr and Y. a mother has the gametes XR and Xr. what is the probability their child will have XRXr gametes? 25% 8 of 9 what classification can be identified by this description: mostly unicellular, cells have nuclei, some have cell walls protists 9 of 9
Comments
No comments have yet been made