Primer Design

Primer Design (PCR)

We may be interested in isolating genes/sections of DNA from circular bacterial plasmids. How would we go about doing this? It would need to be cut out and then amplified. We would have to cut it out using restriction enzymes and amplify using PCR. The use of primers are vital in this process.

The nitrogenous bases of DNA are guanine (G), cytosine (C), thymine (T) and adenine (A).

A bonds with T using 2 hydrogen bonds.

G bonds with C using 3 hydrogen bonds. (STRONG)

Primers need to be designed to be able to isolate a gene of interest. Two types of primers will need to be made: forward and reverse primers.

Dna is written in 5' to 3' direction. So completmentary strand is written backwards (3' to 5' direction).

When designing a forward primer, it would need to be active in the forward direction. (3' end to 5' end). So DNA polymerase can bind to the 3' end and synthesise a strand. The 5' end would be in an inactive state and no strands would be made. So forward primer would bind to the complementary strand first (not the original).

5' ACTCGTGACTGCATTGCCAGGACTACGATTCGT 3' (original strand)

3' TGAGCACTGACGTAACGGTCCTGATGCTAAGCA 5' (complementary strand)

5' ACTCGTGACTGCATTGCCAG 3'    (forward primer - 20bp long) 

DNA polymerase can bind after the final nucelotide (G on the right hand side). After that it synthesises the strand.

A primer needs to be about 20 bases long. It is important to ensure that the primer has annealed firmly, especially on the ends (especially 5' end). If the last bonded pair of bases is A-T, this is a weaker bond as there are only 2 hydrogen bonds holding them together. It is recommended to anneal some more bases until you get to a G-C bond, which is a stonger bond as there are 3 hydrogen bonds holding it…