Taxonomy

These cards break down the sections of taxonomy

HideShow resource information

Facts on taxonomy 1

Classification is the grouping of animals

Taxonomy is the theroy of classification

Relationships in a natural classification are based upon homologous pairs.

  • These homologous characteristics have similar evolutionary origins, regardess of their functions in the adult species.
  • For example the arm of an adult and the wing of a bird have both the same structure and evolved from a common ancestor, therefore they are homologous

An easy way to find out how closely related a species is is by counting how many DNA nucleotides bases match from one to the next!

1 of 8

Facts on taxonomy 2

For example

Guinea pig AAATATCACTAGGAGGATACGATACGGTTA

mouse AATTATCACTACCAGGGTACGATAAAGTTA

there are 26 hydrogen bonds that connect the matching nucleotide bases together

2 of 8

Principles

There are two main forms of biological classifcation, each with their own purpose

Artifical classification

  • divides organisms according to their present differences
  • these may include colour, number of legs, size etc
  • these are ANALOGOUS characterisics
  • - they have the same function but do not have the same evolutionary origins

Natural classification

  • are organised into evolutionary relationships between organisms and their ancestors.
  • the species are then put into groups of shared features, ie how many legs/fur/feathers, derived from their ancestors
  • they are then grouped into a hierarchy, where groups are contained within larger composite groups with no overlap
3 of 8

concept of species

Definitions of sepcies

SPECIES CAN REPRODUCE AND HAVE LIVING, FERTILE OFFSPING!!!!

They are similar to one another but different from members of other species

  • they have similar genes and therefore look very alike, psysically and biochemical.
  • they occupy the same ecological niche - similar patterns of deveopment

They are capable of breeding to produce living offspring

  • therefore able to mass produce
  • they belong to the same gene pool
4 of 8

Organising the groups of species - taxonomy 1

Taxonomy is the study of each group within a natural biological classification, and their positions in hierarchical order. These are known as taxonomy ranks!

Kingdom- is the largest group, where each organism is placed

Phylum- this is the largest group within the kingdom, organisms in these section have a body plan radically different from any other phylum

Class- diversity within each phylum divides into classes

Order- divided from class, organisms that have additional features in common

Family- Divided from the order, organisms with differences less obvious

Genus- divided from family, which is then divided into species

Species!!

5 of 8

Organising the groups of species - taxonomy 2

It can be hard to remember the ORDER of the above so here are a few rhymes to help you,

KING, PHILIP, COUNTS, ON, FUN, GREAT, SEX!!!!

KING, PRAWN, CURRY, OR, FAT, GREASY, SAUSAGES!!!

6 of 8

Phylogeny 1

The evolutionary relationship between organisms is known as PHYLOGENY

  • The phylogeny of an organism reflects the evolutionary branch that it is led up to it
  • The phylogentic relationships of different species are usually represented by a tree-like diagram called a PHYLOGENTIC TREE
  • In these diagrams, the oldest species is at the base of the tree. The most recent species are represented at the ends of the branches.
7 of 8

Phylogeny 2

(http://www.med.nyu.edu/rcr/rcr/course/tree.gif)

common ancester

8 of 8

Comments

No comments have yet been made

Similar Biology resources:

See all Biology resources »See all DNA, genetics and evolution resources »