GENETIC FINGERPRINTING

Gene Technology-   Genetic Fingerprinting

•Each of us has a unique genetic fingerprint/genetic profile is a description of different parts of DNA that are unique to the individual.

•They are so variable that no two individuals in the world will have exactly the same genetic code in all the regions- the only except is in identical genes

 •A cells DNA contains many non coding sections called introns.

•A few of these many introns make up the variable regions used for genetic fingerprinting. Humans have ten of these.

•Within these very variable regions there are repetitive sections of genetic code. These sections are otherwise known as core sequences.

•Core sequences contain short, tandem repeats of genetic code

•Different people will have different numbers of code repeats ie:

Dad:AGTCTTCATGCATGCATGCATGCATGATCTTCGA Mum: GTACGTCATGCATGCATGAGCTG

If you cut the DNA at specific sections in the code- outside of the repeats, the lengths of DNA fragment produced will vary, because of the different lengths of repeated sections they are connected to.

Stage 1; Extraction

The cells present are broken open and the nuclei isolated.

The DNA within the nuclei is isolated and purified

Stage 2; PCR

The fragments of DNA containing the core sequences are copied many thousands of times using the PCR

The fragments are separated using gel electrophoresis. 

Stage 3; Electrophoresis

In an electricity field, the electricity charged DNA is pulled towards one end of the gel. Smaller DNA fragments travel faster than larger ones. In time the mixture of DNA is separated into different bands; each band contains DNA of identical lengths- so each band represents a fragment of DNA with one particular number of repeats belonging to one core sequence.

•The DNA is not easily seen by the naked eye so has to be treated with a fluorescent probe that binds to the DNA so we can see it. •The positions of the band can now be recorded and we have a DNA profile- or genetic fingerprint.