Other pages in this set

Page 2

Preview of page 2

Here's a taster:

DNA code
DNA is a chemical found inside the nucleus. It forms structures called chromosomes. A
section of a chromosome is called a gene. Each gene is a code for making proteins. Our
bodies need to make proteins to grow and repair cells.
Everyone has his or her own unique DNA code.
Question: Why does a cell need to make proteins?
The cell needs protein as Protein provides growth and repair for the cell/organism.
Mitochondria
Cell respiration is carried out inside mitochondria.…read more

Page 3

Preview of page 3

Page 4

Preview of page 4

Here's a taster:

Question: Suggest one reason why muscle cells have a lot of mitochondria.
Muscle cells have a lot of mitochondria so plenty of respiration can take place can
take place providing the cell with plenty of energy.
Question: From where does the body get its supply of amino acids?
Either from meat or fish (Essential proteins ­ ones the body cannot make) or it
produces them in the liver.
Question: Explain how DNA can be used to catch a thief.…read more

Page 5

Preview of page 5

Here's a taster:

When DNA replicates, the two polynucleotide strands unwrap. This exposes strands of
the nucleotides.
Floating about in the nucleus are free nucleotides. The bases of these free floating
nucleotides bonds to the exposed bases on the two strands.
Complementary bases pairing occurs, guanine bonds to cytosine and adenine bonds to
thymine.
A new polynucleotide strand is formed around each of the original strands which wraps
around them forming two double helical DNA molecules.…read more

Page 6

Preview of page 6

Here's a taster:

Question: Write down the complementary base sequence for the section of DNA shown in
the previous question.
TTTATAGAGGGGAGTTGGCCCGCCATTTAC
Making cheese
When making cheese from milk.
First milk is allowed to turn sour using an enzyme called rennin. Rennin is an
enzyme.
The milk separates into a solid called `curd' and a liquid called `whey'.
The curds are then turned into cheese.
Did you know?
Clothes washing detergents use enzymes to speed up the break down of stains. Lipase
enzymes break down fat stains.…read more

Page 7

Preview of page 7

Here's a taster:

Stage 2: label this stage on your graph
Stage 3: label this on your graph after completing the text below.
As temperature continues to increase, the speed of movement of the substrate and enzyme
molecules also continues to increase. However, the enzyme molecule is also vibrating more
and more energetically. Above a certain temperature called the optimum temperature,
bonds between R groups of amino acids holding together the tertiary structure of the active
site, begin to break down.…read more

Page 8

Preview of page 8

Here's a taster:

If he has a very high temperature, it is a sign of an infection which could be passed on
to other people.
(b) How would a protease remove a bloodstain on clothes?
Protease is an enzyme which digests proteins and since blood is mainly made out of
proteins, the stain should be easily removed.
© Most biological washing powders are recommended for use at low washing
temperatures. Why is this?
The enzymes may work best in those particular conditions due to their own optimum
temperature.…read more

Page 9

Preview of page 9

Here's a taster:

Question: Colour the above diagram as follows:
(a) enzyme = green (b) substrate = blue (c) product = red
It can be seen from the diagram that the enzyme is unchanged after it produces product
molecule/s. The rate of an enzyme controlled reaction is dependent on the rate at which
substrate can (a) enter and then bind to the active site to form an enzymesubstrate complex
(b) form product and then (c) leave to allow another substrate molecule to gain access.…read more

Page 10

Preview of page 10

Comments

No comments have yet been made

Similar Biology resources:

See all Biology resources »See all resources »