Pages in this set

Page 1

Preview of page 1
Name __Casey Hindon____








OCR Gateway GCSE Additional Science


B3: Living and growing





































Molecules of life


1

Page 2

Preview of page 2


DNA code

DNA is a chemical found inside the nucleus. It forms structures called chromosomes. A
section of a chromosome is called a gene. Each gene is a code for making proteins. Our
bodies need to make proteins to grow and repair cells.

Everyone has his or her own unique…

Page 3

Preview of page 3
DNA consists of two long molecules called polynucleotides wrapped around each other.

Each polynucleotide strand is made up of small molecules joined together called bases.

Each nucleotide has a `sticky' part to it called a nucleotide base.
Bases of two different nucleotides can bond to each other and this is…

Page 4

Preview of page 4


Question: Suggest one reason why muscle cells have a lot of mitochondria.
Muscle cells have a lot of mitochondria so plenty of respiration can take place can
take place providing the cell with plenty of energy.
Question: From where does the body get its supply of amino acids?
Either from…

Page 5

Preview of page 5
When DNA replicates, the two polynucleotide strands unwrap. This exposes strands of
the nucleotides.

Floating about in the nucleus are free nucleotides. The bases of these free floating
nucleotides bonds to the exposed bases on the two strands.

Complementary bases pairing occurs, guanine bonds to cytosine and adenine bonds to…

Page 6

Preview of page 6


Question: Write down the complementary base sequence for the section of DNA shown in
the previous question.
TTTATAGAGGGGAGTTGGCCCGCCATTTAC

Making cheese

When making cheese from milk.

First milk is allowed to turn sour using an enzyme called rennin. Rennin is an
enzyme.
The milk separates into a solid called `curd' and…

Page 7

Preview of page 7










Stage 2: label this stage on your graph














Stage 3: label this on your graph after completing the text below.

As temperature continues to increase, the speed of movement of the substrate and enzyme
molecules also continues to increase. However, the enzyme molecule is also vibrating more
and more energetically.…

Page 8

Preview of page 8
If he has a very high temperature, it is a sign of an infection which could be passed on
to other people.
(b) How would a protease remove a bloodstain on clothes?
Protease is an enzyme which digests proteins and since blood is mainly made out of
proteins, the stain…

Page 9

Preview of page 9


Question: Colour the above diagram as follows:
(a) enzyme = green (b) substrate = blue (c) product = red

It can be seen from the diagram that the enzyme is unchanged after it produces product
molecule/s. The rate of an enzyme controlled reaction is dependent on the rate at which…

Page 10

Preview of page 10
At high temperatures, the enzyme may become denatured and will not work.

Question: Pepsin is an enzyme found in the stomach. It breaks down proteins into amino
acids. Draw a diagram to explain why pepsin cannot break down starch.

















Diffusion

Moving substances in the body

To stay alive the body…

Comments

No comments have yet been made

Similar Biology resources:

See all Biology resources »See all resources »